Skip to content

przychodnia słupsk banacha ad

2 tygodnie ago

466 words

Całkowite i wolne białko S mierzono za pomocą testu immunoenzymatycznego (Asserachrom Protein S, American Bioproducts). Aktywność antytrombiny III oznaczono za pomocą testu aktywności heparyny-kofaktora (Coatest, Chromogenix, Franklin, Ohio). Aktywność plazminogenu określono za pomocą komercyjnego zestawu (Chromostrate, Organon Teknika, Research Triangle Park, NC). Pula referencyjna prawidłowego osocza dla tych testów została skonstruowana przez zmieszanie równych objętości osocza z więcej niż 30 zdrowymi osobnikami. Fragment protrombiny F1 + 2 mierzono za pomocą testu radioimmunologicznego13. Normalne wartości dla tego testu zostały określone u 26 zdrowych osób w wieku poniżej 50 lat i 28 osób w wieku od 50 do 69 lat, które nie przyjmowały żadnych leków.
Sekwencjonowanie genomowego DNA
Genomowy DNA wytworzono z leukocytów krwi obwodowej14. Startery FV7 (5 CATACTACAGTGACGTGGAC3 ) w eksonie 10 i FV8A (5 TGCTGTTCGATGTCTGCTGC3 ) w eksonie 11, w oparciu o zgłoszoną sekwencję RNA mRNA (mRNA), 15 zastosowano do amplifikacji fragmentu genomowego 3,1 kb obejmującego intron 10 przez łańcuchową reakcję polimerazy (PCR) 16. Produkty PCR wytworzono w 50-mikrolitrowych mieszaninach reakcyjnych, które zawierały 200 ng genomowego DNA; 100 pmol każdego ze starterów FV7 i FV8A; 0,5 jednostki polimerazy Taq (Promega, Madison, Wis.); 200 mikronów M, każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny, 1,5 mM chlorek magnezu, 10 mM kwas TRIS-chlorowodorowy (pH 8,3), 50 mM chlorek potasu i 0,01 mg autoklawowanej żelatyny na mililitr. Reakcje poddano 30 cyklom jednej minuty w 94 ° C, dwie minuty w 60 ° C i trzy minuty w 72 ° C, a następnie 2 cykle dwie minuty w 60 ° C i trzy minuty w 72 ° C. Startery do amplifikacji usunięto z produktów PCR za pomocą kolumn Wizard Prep (Promega). Reakcje sekwencjonowania obejmujące znakowany 35S trifosforan deoksyadenozyny (Amersham, Arlington Heights, IL) przeprowadzono bez dalszego oczyszczania matrycy przy użyciu zestawu do sekwencjonowania cyklicznego (system sekwencjonowania DNA fmol, Promega) i primera czynnika V FV23 (5 ATCGCCTCTGGGCTAATAGG3 ).
Komplementarna sekwencja DNA czynnika V
RNA przygotowano z kożuszków leukocytarnych pełnej krwi zebranych w roztworze antykoagulantu cytrynian-fosforan-dekstroza z RNA-Stat 60 (TelTest B, Friendswood, Tex.). RNA poddano odwrotnej transkrypcji z oligodeoksytymidyny za pomocą komplementarnego zestawu DNA (cDNA) (zestaw cDNA Cycle Kit, Invitrogen, San Diego, CA). Jednoniciowy cDNA zastosowano jako matrycę do amplifikacji PCR ze starterami swoistymi dla czynnika V. Sekwencję kodującą lekki łańcuch czynnika V amplifikowano ze starterami FV9 (5 TGAGATCATTCCAAAGGAAG3 ) i FV14 (5 TTGAGGTCTTAAAGAGTCTC3 ) w obecności 1,5 mmol chlorku magnezu na litr, z 30 cyklami dwie minuty w 56 ° C, trzy minuty w 72 ° C i jedną minutę w 94 ° C. Amplifikacja sekwencji kodującej łańcuch ciężki była taka sama, z wyjątkiem tego, że w reakcji stosowano FV2 (5 TGCCATTCTCCAGAGCTAGG3 ) i FV13 (5 CAGGAAAGGAAGCATGTTCC3 ) w obecności 1,0 mM chlorku magnezu. Startery do amplifikacji zostały usunięte z produktów PCR za pomocą kolumn Wizard Prep, aby umożliwić określenie kompletnej sekwencji kodującego RNA dla czynnika Va
[więcej w: wypadnięcie odbytnicy, sol z morza martwego, endometrioza na jajniku ]

Dodaj komentarz

Twój adres email nie zostanie opublikowany. Pola, których wypełnienie jest wymagane, są oznaczone symbolem *

Powiązane tematy z artykułem: endometrioza na jajniku sol z morza martwego wypadnięcie odbytnicy